                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=13 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGCCAAAGAGGAGGAAGAGGAGGAAGAGGAAGTCAAGGAAGAAGAGGCCATCGAGG
GGCTCGGAGCCCTCTTTGGTTAAttttttgtaaaaatttaaaatttttagatatatttcttttctgcgattttcatttttccc
tcatcccaacattgcatcaacatcttaacttcgttcccatttaggggcttgcagacatcacatgtttgagaaaatattgttctgatggaagttcgataga
aaagtatatatatacctaatactaaattttgtatcgaaaagagataggaggtgtgttggATG

    hpyA1 Gene: hpyA1-2     GI: 11499088     BI number: AF1493     GOG: COG2036     Description: archaeal histone A1 (hpyA1-2                      CG                     T  G                     C  A                     G  G                      GC                      GC                      GC            CG        AT           T  A       GC   G       A  G      C  T A  G       CG       T  T GC        CG        AT GC       G  G       CG TA        GC        CG AT        AT        GT gC        GC        GT                         AAttttttgtaaaaatttaaaatttttagatatatttcttttctgcgattttcatttttccctcatcccaacattgcatcaacatcttaacttcgttcccatttaggggcttgcagacatcacatgtttgagaaaatattgttctgatggaagttcgatagaaaagtatatatatacctaatactaaattttgtatcgaaaagagataggaggtgtgttggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [B] COG2036 Histones H3 and H4 ... can be seen here     ..................................................................................................................