                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:155 nt.     Distance to run of Ts=3 nt.   Size=16 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=51 nt.     Delta G=-13.70 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -5.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGACTTTGTTAACGTAAACCACCTGCCCTCTACTGTTGATTATAATCATCGCGACAG
GAGCCTCGTCAACCACTGTTTTCCAGTCCATTGAGAGTTCCATcgaacatatgttcgactgtttgttt
ttataaagctttttatttgggattatgtcgtttggggattatttctcgctaaaaacgcctttttttaaaagtataaactccacagtagttttttgcttaa
gtagttttcttaagcgatttccggttttcaaacttataaaagcggaaaaaggcttttatatattataagccaaaGTG

    AF1513 Gene: AF1514     GI: 11499109     BI number: AF1514     GOG: -------     Description: hypothetical protei             T           T  T           T  C            GC            TA            CG            AT           C  C           C  C           A  A   A       A  T A  T      C  | T  C      T  | A  A       GT T  T       CG T  C       TA A  G       CG GC       |  A TG        CG TA        GT GC        AT        ta TA        GC       a  t CG        GC        cg A  |      A  A       at T  |      C  |       at CG        AT        gc TA        Gc        cg CG        Cg        Ta                         ctgtttgtttttataaagctttttatttgggattatgtcgtttggggattatttctcgctaaaaacgcctttttttaaaagtataaactccacagtagttttttgcttaagtagttttcttaagcgatttccggttttcaaacttataaaagcggaaaaaggcttttatatattataagccaaaGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_fulgidus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:169 nt.     Distance to run of Ts=3 nt.   Size=16 nt.     Delta G= -6.00 kcal/mol Antiterminator: Size=51 nt.     Delta G=-13.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGGACTTTGTTAACGTAAACCACCTGCCCTCTACTGTTGATTATAATCATCGCGACAG GAGCCTCGTCAACCACTGTTTTCCAGTCCATTGAGAGTTCCATcgaacatatgttcgactgtttgttt ttataaagctttttatttgggattatgtcgtttggggattatttctcgctaaaaacgcctttttttaaaagtataaactccacagtagttttttgcttaa gtagttttcttaagcgatttccggttttcaaacttataaaagcggaaaaaggcttttatatattataagccaaaGTG     AF1513 Gene: AF1514     GI: 11499109     BI number: AF1514     GOG: -------     Description: hypothetical protei   C C  A T  T GT AG CA CG T  A T  G T  T T  T G  | T  | CC AC CA CT |  c Ag Aa Ca        ta Tc       a  t Ga        cg C  t       at T  |       at Ca        gc Ct        cg G        Ta             ctgtttgtttttataaagctttttatttgggattatgtcgtttggggattatttctcgctaaaaacgcctttttttaaaagtataaactccacagtagttttttgcttaagtagttttcttaagcgatttccggttttcaaacttataaaagcggaaaaaggcttttatatattataagccaaaGTG     ..................................................................................................................