                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-13.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGAGCTTTAGGGAAACGGCTTGCTCAGCGGCACTTTCTATGCTTCCAAGAGGTTTCA
GGGCAGCCCTACTTTTCCTTGCCCCAGTAGCCGTGTCTGTTTTCGGCGTAGAGATAGG
ACTGCTTTTCGTTTCACTCGACCTCATTTCGAGGCTCGTAGTTTTTCTTTGAtaaagtgtt
aaaaagtgagataaaaactttgcgaaattatgtgaacgcacttgcccgttagtaccgctccgttgaggaaatatttatatataacaaaaaattaacataa
tctattgttgaaaaggtggttgtATG

    AF1527 --- AF1526 --- AF1525 --- AF1524 Gene: AF1527     GI: 11499122     BI number: AF1527     GOG: COG1417     Description: conserved hypothetical protein Gene: AF1526     GI: 11499121     BI number: AF1526     GOG: COG0589     Description: conserved hypothetical protein Gene: AF1525     GI: 11499120     BI number: AF1525     GOG: COG0730     Description: conserved hypothetical protein Gene: AF1524     GI: 11499119     BI number: AF1524     GOG: -------     Description: hypothetical protei   C C  G G  T A  G T  T GC AT CG |  T        G |  T      T  C |  T      C  T |  T       AT C  C       GT CG       G  T CG       A  C GC        TG TG        AT T  T       GT C  A       AT         T CG        GC       T  T TA       A  |      A  C TG        TA        CG TA        GC        TA T  |      C  |       CG C  |       GT        CG AT        GC       |  C TA        CG        AT CG        TA        GC CG       T  C       CG C  A      T  C      |  T GC       T  T       TA AT        GC        CG CG        TA        AT                         TTTTCTTTGAtaaagtgttaaaaagtgagataaaaactttgcgaaattatgtgaacgcacttgcccgttagtaccgctccgttgaggaaatatttatatataacaaaaaattaacataatctattgttgaaaaggtggttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1417 Uncharacterized conserved protein ... can be seen here [T] COG0589 Universal stress protein UspA and related nucleotide-binding proteins ... can be seen here [R] COG0730 Predicted permeases ... can be seen here     ..................................................................................................................