                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -9.03 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGGGAAAAGGGGGCGTTTGATAGTATTAGGCTGACAAGCATTATCGGAACTACCTT
TGACATTAGCGTTAGTGTTTGCAGCAGGGCGTAGTTCACGTCCACcctccccaatcgccttggggtt
tattaagctttgaactcctgccgaactcacagttctttgacgatggaaaattacccctaaccgcgtctatactaaaggtattaagcttctaccaaactca
actgtaaccaaccctttaatccatttgcaaaaagccttaaatatacttccggtgtcagtgagaaggggatcgacaATG

    rpl21E --- AF1530 --- AF1531 --- AF1532 Gene: rpl21E     GI: 11499124     BI number: AF1529     GOG: COG2139     Description: LSU ribosomal protein L21E (rpl21E) Gene: AF1530     GI: 11499125     BI number: AF1530     GOG: COG1460     Description: conserved hypothetical protein Gene: AF1531     GI: 11499126     BI number: AF1531     GOG: COG1491     Description: conserved hypothetical protein Gene: AF1532     GI: 11499127     BI number: AF1532     GOG: COG1873     Description: conserved hypothetical protei             T           G  T           A  C TT        TA G  A       GC CG        CG GT        GT A  G       GC T  T       GC T  T      A  A AT       C  C CG       G  c |  C      A  c |  A      C  t A  G      G  c GC       T  c TA       T  c TG       T  | TG        Gc         g CG        Ta       c  c |  C      G  a      t  c CG       A  t       at AT       T  |       at TA       T  |       cg CG        Gc        cg AT        Cg        cg AT        Gc        cg                         tttattaagctttgaactcctgccgaactcacagttctttgacgatggaaaattacccctaaccgcgtctatactaaaggtattaagcttctaccaaactcaactgtaaccaaccctttaatccatttgcaaaaagccttaaatatacttccggtgtcagtgagaaggggatcgacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG2139 Ribosomal protein L21E ... can be seen here [S] COG1460 Uncharacterized protein conserved in archaea ... can be seen here [J] COG1491 Predicted RNA-binding protein ... can be seen here [S] COG1873 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................