Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -9.23 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCCCCCCTTTGCTGACAGCAACACTCCCGGCATTGTATCTACCCCTGACAGGCTTTA
AGGTCAGCTATGATCTGCTGCCCGTTGTTGGATACCTAACATATTCGCAGTTTTTGCT
ACTCCTGCTGCAGCTTCAACGATAAtactcgctccactaattgacaggctcggagaaggctttcaggtaacgaaaattacca
ttctaagggacccgtatctgaactgcctcagctcttcacgatctcttcgctggtttacgttactttctacggcatgcaaaagcttagaaatggaggtgga
gcATG

    AF1579


Gene: AF1579     GI: 11499174     BI number: AF1579     GOG: -------     Description: hypothetical protei


  C
A  C
T  C
C  C
T  T
A  G
 TA
 GC
 TA        CT
 TG       G  A
A  |       AT
 CG        CG
 GC        TA
 GT        GT
C  T       GC
C  T       AT        TA
C  A      A  G      A  C
T  A      T  C       GC
C  G      T  T       GT
A  |      T  |       TA
C  |       CG        TA
A  |       GC        GC
A  |       GC        TA
C  |      |  C      |  T
G  |      |  G      T  A
A  |      |  T      G  T
 CG        AT       C  T
 AT        CG       C  C
 GC        AT        CG
 TA        GT        GC
 CG        TG        TA
 GC        CG        CG
                        TTTTTGCTACTCCTGCTGCAGCTTCAACGATAAtactcgctccactaattgacaggctcggagaaggctttcaggtaacgaaaattaccattctaagggacccgtatctgaactgcctcagctcttcacgatctcttcgctggtttacgttactttctacggcatgcaaaagcttagaaatggaggtggagcATG


    ..................................................................................................................