Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=23 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTCGTCAAACCAACTTTGCAGCTTTTTGCAGCAATATCAACCATCTCCCCAATGTT
CGGGTTGAGCAGAGGCTCCCCCCAGCCCTGCAGATGGGCGTAATGGAACTTTTTGAAG
GGGATGAGCCTGAAAGTTTCCATATTCATGTCCTTGGCTATCCACTCATCGCTAAAGC
AGGATTTCGGGCACATCAGGCAGCTAAGCTGACACCTCGTCGAAACCTCAACCTGAAC
GAAGCCGAGTTTGGGCATaatggctgttgatggaaaggttaattacttttggtgccaattaaacttcaATG

    AF1614 --- AF1613


Gene: AF1614     GI: 11499206     BI number: AF1614     GOG: COG2250     Description: conserved hypothetical protein
Gene: AF1613     GI: 11499205     BI number: AF1613     GOG: COG1708     Description: conserved hypothetical protei


 CA
C  A
C  T
C  G
T  T
C  T
T  C
A  G
 CG
 CG
 AT
 AT
 CG
 TA
A  |
T  |                  A
A  |                C  G
A  |                G  A
C  |                T  T
G  |       CC        CG
A  |      C  C       CG
 CG       C  C       CG
 GC        TA        GC
T  |       CG       A  G
 TA        GC       C  T
 TG        GC       C  A
 TA       A  |      C  A
 TG        GC       C  T
 CG        AT        CG
 GC        CG        CG
 AT        GC        TA
                        ACTTTTTGAAGGGGATGAGCCTGAAAGTTTCCATATTCATGTCCTTGGCTATCCACTCATCGCTAAAGCAGGATTTCGGGCACATCAGGCAGCTAAGCTGACACCTCGTCGAAACCTCAACCTGAACGAAGCCGAGTTTGGGCATaatggctgttgatggaaaggttaattacttttggtgccaattaaacttcaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG2250 Uncharacterized conserved protein related to C-terminal domain of eukaryotic chaperone, SACSIN ... can be seen here
[R] COG1708 Predicted nucleotidyltransferases ... can be seen here

    ..................................................................................................................