Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=2 nt.   Size=14 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=78 nt.     Delta G=-10.87 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCCTGTCCAGAATGCTTGGATTGAGCTTTGTGTCGAACATCAGCTGCGAGAACTTC
TTTGGGCCATCGCTTAGACTGTAGAGGATGTCGCTCACACCCTTCCTCCCGATAATCT
TAAGTACTTCCTTAACGCTGATATCGAGTTCCTCCATGTTCTCAGCCTCGATCACTTC
ACCCACcgttcaacacttctccctcttattcttaaagttatctttgtatagaaaaattatatttttgtaattacttttatgtttgcggggcgaaag
tccttatattttggagcccaatgtgcatttATG

    AF1808


Gene: AF1808     GI: 11499396     BI number: AF1808     GOG: -------     Description: hypothetical protei


  t
t  a
a  t
a  a
 at
 at
 at
 gt
 at
 tg
 at
 ta
g  a
t  t
t  t
t  |
c  |
t  |
a  |
t  |
 ta
 gc
 at
 at
 at
t  t
t  a
c  t
t  g
t  t
a  t
t  t
t  g
c  c
 tg
 cg        aa
 cg       g  a
 cg        cg
t  c       gt
 cg        gc
 ta        gc
 ta        gt
            tatattttggagcccaatgtgcatttATG


    ..................................................................................................................