                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:194 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGATAATAAGGGCAGTGTTGGCAGAACCGCCAATTTCGATGTGCATTCCATCCTTT
ACGAGGTTTGCAGCCTCTTCGGGGCTGATGAGCTTTCTTTCATATTCTTTCTGGTAGT
CCATatcaccacctctaccttaaaaattatgctgacaatttaaccttttctaaaaagattttgcggtagtttaggaaattttttaaaattaaagata
ttgaaagttcattgtcaacatttaaacaattttaacattaccaactttaatcgggaaattttttaagggatttggcaattatagattATG

    entE Gene: entE     GI: 11499440     BI number: AF1855     GOG: COG0318     Description: 2,3-dihydrosybenzoate-AMP ligase (entE             T           T  C TT       C  G T  A       TG C  C       CG CG        CG TA        GC A  |       AT CG        CG CG       |  A T  T       GT T  T       TG AT        TA CG        TG GC        GC TA        GT             TTCTTTCATATTCTTTCTGGTAGTCCATatcaccacctctaccttaaaaattatgctgacaatttaaccttttctaaaaagattttgcggtagtttaggaaattttttaaaattaaagatattgaaagttcattgtcaacatttaaacaattttaacattaccaactttaatcgggaaattttttaagggatttggcaattatagattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_fulgidus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.50 kcal/mol Antiterminator: Size=27 nt.     Delta G= -6.60 kcal/mol Anti-antiterminator:   Size=34 nt.     Delta G= -5.79 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTCGATAATAAGGGCAGTGTTGGCAGAACCGCCAATTTCGATGTGCATTCCATCCTTT ACGAGGTTTGCAGCCTCTTCGGGGCTGATGAGCTTTCTTTCATATTCTTTCTGGTAGT CCATatcaccacctctaccttaaaaattatgctgacaatttaaccttttctaaaaagattttgcggtagtttaggaaattttttaaaattaaagata ttgaaagttcattgtcaacatttaaacaattttaacattaccaactttaatcgggaaattttttaagggatttggcaattatagattATG     entE Gene: entE     GI: 11499440     BI number: AF1855     GOG: COG0318     Description: 2,3-dihydrosybenzoate-AMP ligase (entE ga a  t                  T t  t                T  C a  A       TG       C  G t  T      A  T       TG t  G      G  G       CG a  C       CC        CG a  C       TA        GC cG       T  |       AT gC        TT        CG gC        AT       |  A tA       A  C       GT tA       C  C       TG t  T       CA        TA aT        GT        TG gT        CC        GC gC        CC        GT                         TTCTTTCATATTCTTTCTGGTAGTCCATatcaccacctctaccttaaaaattatgctgacaatttaaccttttctaaaaagattttgcggtagtttaggaaattttttaaaattaaagatattgaaagttcattgtcaacatttaaacaattttaacattaccaactttaatcgggaaattttttaagggatttggcaattatagattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here     ..................................................................................................................