                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:6 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=22 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGCTTTTCATCGGGAACATCTCCGCTTTCGAGGACTTTTGCAAATTCCCTTTTCAG
TTTGCGGTGAATCTCAAGCATTTCATCAAGACTCTCAGCCTTTTCCGCATTAATTCGC
TTGGCTATCTGAAATTTGGCCAGCGCCTCTCCCCTGTTTATCGCCTCATACCTTTCAA
GGCCAACCACcacataaaatgtcgaatgtcaaattagataacggtttttgttcaaaaaatattctgtatacgccatgaataatttcggccctc
ggtggggctgaagcgtcgccgactttttccacaTTG

    AF1962 Gene: AF1962     GI: 11499544     BI number: AF1962     GOG: -------     Description: conserved hypothetical protei   t c  g t  t ta at ta a  c a  g a  c a  c a  a at cg ta ta                  ga gt        gg       t  a ta       c  t       cg ta        tg        gc |  t       cg       g  g |  t       cg        gt |  t       cg        gc t  c       gc        tg tg        gt        gc tg        cg        gc gc        ta        cg gc        ta        ta                         ctttttccacaTTG     ..................................................................................................................