Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-14.16 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGCTTGGAGAGGAAATAAAGGCTGAAGAGGAAGCTGAGAAGGAAGGAGAGAGTGGC
GAGGAGGAAGAGCAGACTGAAGAAAAAGAGGAGTGAattttcataaaaattttttattggtatatagtggctt
cgattagtattttatagttcaagtttacataactatagttataacaagaagcctttctctccaagattggtttcttgtttggatgagagtggtagattga
agcttgaattatgcaaattggaacgaatctggaagattttgccgtcttccagcggaataaaatttagagGTG

    AF1990 --- AF1991 --- AF1992 --- AF1993 --- AF1994


Gene: AF1990     GI: 11499572     BI number: AF1990     GOG: -------     Description: hypothetical protein
Gene: AF1991     GI: 11499573     BI number: AF1991     GOG: -------     Description: hypothetical protein
Gene: AF1992     GI: 11499574     BI number: AF1992     GOG: -------     Description: calcium-binding protein, putative
Gene: AF1993     GI: 11499575     BI number: AF1993     GOG: -------     Description: hypothetical protein
Gene: AF1994     GI: 11499576     BI number: AF1994     GOG: -------     Description: hypothetical protei


  t
t  t
g  a
a  c
a  a
c  t
 ta
 ta
 gc
 at
 ta
 at
 ta
 tg
t  t
t  |
 at
 ta
 gt
a  a
t  a
t  c
a  a
g  a
 cg
 ta
 ta         c
 cg       t  c
 gc       c  a
 gc        ta
t  t       cg
g  t       ta
a  t      t  t
t  c      t  t
a  t       cg
t  c       cg
a  t       gt
t  |       at
 gc        at
 gc        gc
            ttgtttggatgagagtggtagattgaagcttgaattatgcaaattggaacgaatctggaagattttgccgtcttccagcggaataaaatttagagGTG
    ..................................................................................................................