                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-22.90 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGAGAGTTACAGTTACAGATCTGGACTGAaggtaagctttataatcccatttagagcaactcatccaagggccgg
tagctcagtctggtagagcgtcgccttggcatggcgaaggcctggggttcaaatccccaccggtccatgccatattctgcgtgtaaccgttctttagaac
tgctaagtattgccttagctgcaatattcactttttactcccatacaactctatagctgcatcctcaagccaactgaaaaaccgaccggagcaaagcttt
taagattgcagagaacattgggcATG

    AF2093 --- AF2094 Gene: AF2094     GI: 11499677     BI number: AF2094     GOG: -------     Description: hypothetical protein Gene: AF2095     GI: 11499678     BI number: AF2095     GOG: COG1990     Description: conserved hypothetical protei gc a  g g  t        a a  c      c  a tg       t  a gc       t  t gc        gc |  t       gc t  t       gc cg        gc tg        ta gc       c  | |  a      c  |       at at        gc       t  t cg        gc       a  c t  |      a  g      c  t cg       a  g       cg gc       g  t       gc a  g      c  |       tg t  a       gc        at g  a       gc        cg g  |       ta       |  t cg        at       c  a cg        cg        ta gc        gc        gc gc        gc        gc gt        ta        cg                         ttctttagaactgctaagtattgccttagctgcaatattcactttttactcccatacaactctatagctgcatcctcaagccaactgaaaaaccgaccggagcaaagcttttaagattgcagagaacattgggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1990 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................