                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCTGCTTCCCCTTCTCTGTTATCACCACAAACTGCCCGTCTTTGGTGAGTGTGCGG
TCTATTAGCCCTTCATCTTCGAGCTCCTTCAGTTTTCTCGCAGCTGTCTGCAGACTCT
GCCCTATGTGCTCTGCAAGCTCCTTTGAGCTTATTTTCACGACCTTCCTTGTCGCGTT
CATCATCGCCAAGGCCTTGAGGACTTCGAGCATCTCATATATGAGAAGCACCTCAAAA
AATTTAAAGGTTTTTATATCACGAACCATcgtgaggaaggcttttattggctctggactactctttttGTG

    AF2105 --- AF2104 --- AF2103 --- AF2102 Gene: AF2105     GI: 11499688     BI number: AF2105     GOG: COG1977     Description: hypothetical protein Gene: AF2104     GI: 11499687     BI number: AF2104     GOG: COG0535     Description: hypothetical protein Gene: AF2103     GI: 11499686     BI number: AF2103     GOG: COG0477     Description: conserved hypothetical protein Gene: AF2102     GI: 11499685     BI number: AF2102     GOG: COG0477     Description: conserved hypothetical protei            AA           A  T           A  T           A  T       CC           A  A      A  A           C  A       AT            TA        Gc            CG        Cg            CG        At            AT        Cg           C  |       Ta AT       G  |      A  g T  A      A  |      T  | AT        AT       A  | CG        GT        Tg TA        AT        Ta CG        GT        Ta TA        TA        Tg A  A       AT        Tg CG        TA        Gc GC        AT        Gt                         tttattggctctggactactctttttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1977 Molybdopterin converting factor, small subunit ... can be seen here [R] COG0535 Predicted Fe-S oxidoreductases ... can be seen here [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................