Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:150 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=79 nt.     Delta G=-22.60 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgtgaaaatgggcgccaaactcctttacatagttcttttcacagatgtagcactgctcctcctgtcaagctttgttgaaatcggcgtgagaggtacttga
tgtacctttgcggccttgcaatgacagctgcgctgtcctgctactttttagcgttcttaaggattgctttgaagaaagtgttgtgagcaactgtctaaaa
taaaagaaaaatttataagctaagaaatagcatggtgaatgggtcagggtttggagccgtttgcaatgaataaactctggggtagatctggtgatgggcc
ATG

    AF2130


Gene: AF2130     GI: 11499713     BI number: AF2130     GOG: -------     Description: hypothetical protei


            g
          t  a
          t  t
           cg
           at
           ta
           gc
           gc
           at
           gt
           at
          g  |
           tg
           gc
          |  g
           cg
           gc
           gc
          c  t
          t  t
          a  |
          a  |
          a  |
          g  |
          t  |
           tg
           gc
           ta
           ta
          t  |
  g       c  |
t  a      g  |
t  a      a  |
g  a       at
t  t       cg         g
t  c       ta       t  c
 tg        gc        cg
 cg        ta        gc
 gc        cg        at
a  g      c  c       cg
 at       t  t       at
 cg       c  |       gc
 ta       c  |      t  c
g  g      t  |      a  |
 ta        cg        at
 cg        gc        cg
 cg        tg        gc
                        tactttttagcgttcttaaggattgctttgaagaaagtgttgtgagcaactgtctaaaataaaagaaaaatttataagctaagaaatagcatggtgaatgggtcagggtttggagccgtttgcaatgaataaactctggggtagatctggtgatgggccATG


    ..................................................................................................................