                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAACAAAGCTTTCGTATTCGAATTTCGACTCATAGCTTAATTCCTGCATCCTCCTC
CATATCGTGAGGTGTGAAGGAGACTCTGTCAGTCTCTCAAGCCTCTGCCTTGATTCCC
TGTAGCTCATggataaagcataatcgatggctattgctgctatatctggctgatatagccttttctcgtcgaattctattaagttgtagaggg
ggcagaaggttctgcctattgatttgtctttgagtcttgtaacggtttttctaagcagcgttacgatcgttctcttttctctgctgtgtttATG

    AF2188 Gene: AF2188     GI: 11499770     BI number: AF2188     GOG: -------     Description: conserved hypothetical protei            gc           a  a       at   G       a  t      t  c A  C      a  a       at T  T       ta        tg GC        at        cg TA        gc        gc C  T      g  g      t  t Cg        Ta       c  g Cg        At       g  a Ta        Cg       t  t T  t      T  |       ta A  a       Cg        at G  |       Gc        ta Ta        At        cg Ta        Ta        gc Cg        Gt        gc                         ttttctcgtcgaattctattaagttgtagagggggcagaaggttctgcctattgatttgtctttgagtcttgtaacggtttttctaagcagcgttacgatcgttctcttttctctgctgtgtttATG     ..................................................................................................................