                                                                        Gene putatively regulated by attenuation in A_fulgidus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=3 nt.   Size=25 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-16.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCCAAAATGCTCGGCTTCAGCATGGAGCACATCAGCCAGGGTTTGGTGGTGAAGGC
CATTGGAAACACCTACTCCGGCTCCTCTCTGCTCGGCCTCGCGGCAACGCTTGACGTT
GCAGAGCCTGATGAGAGGATACTGCTGGTTTCTTCGGCTCAGGAGCTGGAAGTGATGC
CTTTGCCATAAgggtcaccgatgcgattgaaaattatccgagggagccgaaggtttgggagaagattgagaggaaggcgtatgtggattatg
caatatatctgaagcacaggaggaagataaaggcATG

   ق --- acaB Gene: acaB-12     GI: 11499992     BI number: AF2416     GOG: COG0183     Description: 3-ketoacyl-CoA thiolase (acaB-12) Gene: AF2417     GI: 11499993     BI number: AF2417     GOG: COG1545     Description: conserved hypothetical protei CA G  A GC CG GC C  T T  T C  G       TG C  A      A  A G  |      G  G GC        TA CG        CG |  T       CG T  T      |  A CG       G  T GC       A  A TA        GC CG        AT TA        CG CG        GC             TGGTTTCTTCGGCTCAGGAGCTGGAAGTGATGCCTTTGCCATAAgggtcaccgatgcgattgaaaattatccgagggagccgaaggtttgggagaagattgagaggaaggcgtatgtggattatgcaatatatctgaagcacaggaggaagataaaggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0183 Acetyl-CoA acetyltransferase ... can be seen here [R] COG1545 Predicted nucleic-acid-binding protein containing a Zn-ribbon ... can be seen here     ..................................................................................................................