                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGATGGACAATATCCCGGTTGTAATTGAGGAAATAAAAGAAATGGATATAAAAGTG
AAGAATATGAAGCTTAAAACATTAGAAAATGGTTCTCATTATTTACATCTTAAATTAT
GTATCGATCAAAAAAGACATACTGCCGATGTTTACTATTCTCTCCAGCATCTTGAAAG
TGTTCAACAAACTGAGGTGGAAAGTATGTAAcgcaaaacaaactctcttttaaaattagagagtttttcttttttct
ataatggcaacaatgaatgtagtcctgtaaagtaaggaggaattggcaaTTG

    BA_0002 Gene: BA_0002     GI: 21397377     BI number: BA_0002     GOG: COG1226     Description: hypothetical protein predicted by GeneMar gc c  a        a A  a      a  a A  a      t  a Ta       t  t Gc       t  t Ta        ta A  a       cg Ta        ta Gc        cg At        ta A  c       cg At        at Gc        at Gt        at             ttcttttttctataatggcaacaatgaatgtagtcctgtaaagtaaggaggaattggcaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1226 Kef-type K+ transport systems, predicted NAD-binding component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.20 kcal/mol Antiterminator: Size=30 nt.     Delta G= -4.10 kcal/mol Anti-antiterminator:   Size=35 nt.     Delta G= -3.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAAGATGGACAATATCCCGGTTGTAATTGAGGAAATAAAAGAAATGGATATAAAAGTG AAGAATATGAAGCTTAAAACATTAGAAAATGGTTCTCATTATTTACATCTTAAATTAT GTATCGATCAAAAAAGACATACTGCCGATGTTTACTATTCTCTCCAGCATCTTGAAAG TGTTCAACAAACTGAGGTGGAAAGTATGTAAcgcaaaacaaactctcttttaaaattagagagtttttcttttttct ataatggcaacaatgaatgtagtcctgtaaagtaaggaggaattggcaaTTG     BA_0002 Gene: BA_0002     GI: 21397377     BI number: BA_0002     GOG: COG1226     Description: hypothetical protein predicted by GeneMar GT A  G AT AT        GT GC       G  G TA       A  G TA       G  A        a C  C       TA       a  a T  A       CA       t  a A  A       AG       t  t C  A      A  T      t  t GC        AA        ta AT        CT        cg C  |       AG        ta CG       A  T       cg TA        CA        ta CG        TA        cg TG        Tc        at                         ttttcttttttctataatggcaacaatgaatgtagtcctgtaaagtaaggaggaattggcaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1226 Kef-type K+ transport systems, predicted NAD-binding component ... can be seen here     ..................................................................................................................