                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGCATCGATACGTTTACACAAGAGCCGATTCAAAAAGACAATCCGCTCTTATCATT
ACAAAACGTTGTGACTTTACCACACATCGGATCTGCAACATTAAAAACTAGGCAGCAA
ATGGCTATGACCGCCGCTGAAAATTTAGTTGCAGGGTTACAAGGAAAAACACCACCGA
ATATTGTTCGCGGGTAAtatggaataaacgaaaggcaagatgacatcgtcatcttgcctttttttgttaacatattttcttttctctt
ggagatgatatgaacaaaaatcaatggagtgacaaaaaATG

    BA_0010 Gene: BA_0010     GI: 21397385     BI number: BA_0010     GOG: COG0596     Description: abhydrolase, alpha/beta hydrolase fol             T           A  T            TG            AT            AT            GC            CG           C  C           A  G            CG            CG            AT           C  A           A  A           A  t           A  a           A  t           A  g           G  g AA       G  a A  T      A  a AT       A  t GT       C  a        t TA       A  |      a  c CG        Ta        cg GT        Ta        at C  T       Gc        gc CG       |  g       ta GC       |  a       at |  A      G  a       gc |  G      G  a       at CG       A  g       at CG        Cg        cg AT        Gc        gc GT        Ta        gc TA        Ta        at                         ttttttgttaacatattttcttttctcttggagatgatatgaacaaaaatcaatggagtgacaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0596 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-21.00 kcal/mol Antiterminator: Size=68 nt.     Delta G= -8.50 kcal/mol Anti-antiterminator:   Size=23 nt.     Delta G= -6.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAGGCATCGATACGTTTACACAAGAGCCGATTCAAAAAGACAATCCGCTCTTATCATT ACAAAACGTTGTGACTTTACCACACATCGGATCTGCAACATTAAAAACTAGGCAGCAA ATGGCTATGACCGCCGCTGAAAATTTAGTTGCAGGGTTACAAGGAAAAACACCACCGA ATATTGTTCGCGGGTAAtatggaataaacgaaaggcaagatgacatcgtcatcttgcctttttttgttaacatattttcttttctctt ggagatgatatgaacaaaaatcaatggagtgacaaaaaATG     BA_0010 Gene: BA_0010     GI: 21397385     BI number: BA_0010     GOG: COG0596     Description: abhydrolase, alpha/beta hydrolase fol             a           a  a            gg            cg            ac            aa            aa           t  g           a  a            at            gg            ga           t  c           a  a           t  t           A  c           A  g           T           G           G          t           G        a  c           C         cg           G         at           C  |       gc   T        T        ta A  T       T        at TG        G        gc AT       |         at AT       |         at GC       T         cg CG       T         gc C  C      A         gc A  G       T        at CG        A        at CG        A        at AT        G        gt                         tttgttaacatattttcttttctcttggagatgatatgaacaaaaatcaatggagtgacaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0596 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) ... can be seen here     ..................................................................................................................