                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-27.60 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-14.81 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggaaccgcg is shown in italic-bold style

tgttcattattattaatataagtagcgatgacggacttataagtacttgcacaaaaagcgattcagggatagtgaaagcctgaagccgcaaggaaacggc
agtctcgagcaatacgtgataaagtggatgcaccttttgtgtatcaactagggtggaaccgcgggcaaacgctcgtccctaggcaattaagccttgggat
gagcgtttttttatgtttttcaaagcatatactgctcgtttcacaagttacctgagcacgtcatcgccaatacgttaactttcaaaaggaggattttatt
ATG

    BA_0020 Gene: BA_0020     GI: 21397395     BI number: BA_0020     GOG: COG0423     Description: HGTP_anticodon, Anticodon binding domai at t  c g  a ta gc t  t t  | ta        aa tg       a  c cg        cg        tt cg        gc       a  a at        gt       a  a cg        gc        cg g  g       cg        gc t  a       gt        gc a  a      c  |       at gc       c  |      t  t gc       a  |       cg tg       a  |       cg gc       g  |       cg a  g      g  |       ta a  g      t  |       gt a  g       gc        cg t  c       gc        ta a  a       gc        cg g  a       at        gc ta        ta        cg gc        cg        at                         ttttttatgtttttcaaagcatatactgctcgtttcacaagttacctgagcacgtcatcgccaatacgttaactttcaaaaggaggattttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0423 Glycyl-tRNA synthetase (class II) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................