                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGAAAGATGTTTATAGCCAATGGGGTAAGAAAAAAGTAAATGTATATGTAGTTAAG
ATAGGAAATGGTAAGTTTTCAGAAGAAGAGTTAACGATGTTAAACCAAGATGAGACGA
TGCAAGTGTTTCGCGGACAATATTTAAAACAAAGATAGtctagtggtaattgcgctagactttttttatttt
atattggaggaaatagggactagatagaatgtaacagaagttagaattgtcgcattttatcgaaaataaagttataataaaggtagagtagagaaattta
gggggtctgaacATG

    BA_0028 Gene: BA_0028     GI: 21397403     BI number: BA_0028     GOG: COG0260     Description: Peptidase_M17, Cytosol aminopeptidase family, catalytic domai   C G  A T  A A  G GT CG AT         A GT       A  C        a AT       A  A      a  t GC       A  A      t  t TG        TA       g  g A  C       TG        gc G  |       TA        tg A  |       AT        gc A  |       TA        at CG       A  |       ta CG       A  |       cg A  A       CG        ta A  C       At        Gc A  |       Gc        At TA        Gt       T  t TA       |  a       At GT        Cg        Gt TA        Gt        At AT        Cg        At GT        Tg        At                         attttatattggaggaaatagggactagatagaatgtaacagaagttagaattgtcgcattttatcgaaaataaagttataataaaggtagagtagagaaatttagggggtctgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0260 Leucyl aminopeptidase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:119 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.10 kcal/mol Antiterminator: Size=36 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:   Size=21 nt.     Delta G= -3.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGTGAAAGATGTTTATAGCCAATGGGGTAAGAAAAAAGTAAATGTATATGTAGTTAAG ATAGGAAATGGTAAGTTTTCAGAAGAAGAGTTAACGATGTTAAACCAAGATGAGACGA TGCAAGTGTTTCGCGGACAATATTTAAAACAAAGATAGtctagtggtaattgcgctagactttttttatttt atattggaggaaatagggactagatagaatgtaacagaagttagaattgtcgcattttatcgaaaataaagttataataaaggtagagtagagaaattta gggggtctgaacATG     BA_0028 Gene: BA_0028     GI: 21397403     BI number: BA_0028     GOG: COG0260     Description: Peptidase_M17, Cytosol aminopeptidase family, catalytic domai             C           A  A           G  A           G  T            CA            GT            CT            TT         a            TA       a  t   C       T  |      t  t G  A      G  |      g  g T  A       TA        gc A  G       GA        tg GT        AA        gc CG        AC        at AT       |  A       ta GT        CA        cg AT        GA        ta GC        TG        Gc TG        AA        At                         ttttttattttatattggaggaaatagggactagatagaatgtaacagaagttagaattgtcgcattttatcgaaaataaagttataataaaggtagagtagagaaatttagggggtctgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0260 Leucyl aminopeptidase ... can be seen here     ..................................................................................................................