Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCATCTTTTGTCATCACTTTTGCTTTTCCATCCAAAACGTCATCGCCATTCCCGCCAA
TAATTTCAGCTGAGGGACGAGGCGTTGGCAATCCACCTAATACTTCAGGACAAATGAG
GACTGTATCTTCTTTTTGCAGGAGCTCCTCTATTTTTGAAATGAGATTGTCGTTTCCA
TCATAACGACAAGCAATACCACCTAAACAAGCGCTAATTACGATCATattttcatctccaataaa
aaatattaattaccacgccaaattcccttccgactccttatttataagtgaggtgataaaaATG

    BA_0038


Gene: BA_0038     GI: 21397413     BI number: BA_0038     GOG: -------     Description: HTH_ASNC, helix_turn_helix ASNC typ


           AA
          C  T
           GC
           GC
           TA
          T  |
          G  |
          C  |
  T        GC
T  T       GC
A  C       AT
A  A      G  A
T  G      C  A
A  C      A  T
 AT       G  A
 CG        GC         C
C  A       GT       T  T
G  |       AT       T  T
 CG        GC       C  T
 CG        TA       T  T
 CG        CG        AT
 TA       G  G       TG
|  C      A  A       GC
T  G      C  C       TA
A  A       TA        CG
 CG        TA       |  G
 CG        TA       |  A
 GC        AT       |  G
 CG       A  G      |  C
T  T      T  A       AT
 AT       A  |       GC
 CG       A  |       GC
 TG        CG        AT
 GC        CG        GC
                        TATTTTTGAAATGAGATTGTCGTTTCCATCATAACGACAAGCAATACCACCTAAACAAGCGCTAATTACGATCATattttcatctccaataaaaaatattaattaccacgccaaattcccttccgactccttatttataagtgaggtgataaaaATG


    ..................................................................................................................