                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:52 nt.    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.20 kcal/mol
Antiterminator:    Distance from promoter:22 nt. Size=39 nt.     Delta G= -5.14 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcaa-ttttct. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcaatcggcagcacctttttcttttctattagataaaattttatttcgcaggggaggataatattgtatataaataaaaaaggccctttttagaaggg
cttttttcttacacaatttgcgcaagaatggctcatcgccaaatgttgtcaaatatgagaaacgggggacattcatattgtgttctaaaagcgtgcattt
tatacttaacataacaaattatttttggagtgaatacaaATG

    BA_0043 Gene: BA_0043     GI: 21397418     BI number: BA_0043     GOG: COG0253     Description: DAP_epimerase, Diaminopimelate epimeras at a  t at at ta at gt at t  c t  g        t a  c      a  a ta       t  t cg       g  a t  g       ta t  g       ta tg        at ta        ta cg       a  a        t tg       a  a      t  a ta       t  a       tg |  t      a  a       ta t  a      g  a       ta t  a      g  g       cg t  t      a  g       cg c  a       gc        cg c  t       gc        gc at        gc        gt cg        gt        at gt        at        at                         tttcttacacaatttgcgcaagaatggctcatcgccaaatgttgtcaaatatgagaaacgggggacattcatattgtgttctaaaagcgtgcattttatacttaacataacaaattatttttggagtgaatacaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0253 Diaminopimelate epimerase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:212 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.50 kcal/mol Antiterminator: Size=46 nt.     Delta G= -8.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTAGAAGAACTTGTAAACAATGTATATGAGTATTTGGATGAAAATCCAATGTTTTAAg gtgttgcaatcggcagcacctttttcttttctattagataaaattttatttcgcaggggaggataatattgtatataaataaaaaaggccctttttagaa gggcttttttcttacacaatttgcgcaagaatggctcatcgccaaatgttgtcaaatatgagaaacgggggacattcatattgtgttctaaaagcgtgca ttttatacttaacataacaaattatttttggagtgaatacaaATG     BA_0043 Gene: BA_0043     GI: 21397418     BI number: BA_0043     GOG: COG0253     Description: DAP_epimerase, Diaminopimelate epimeras AA G  A TA AT GC GC TA TA T  T A  G T  T GT AT         t GT       a  c TA       a  g |  A       cg |  g       gc |  g       ta |  t       tg A  g       gc T  t       ta At        gc Tg        gc Gc        At Ta        At             tttcttttctattagataaaattttatttcgcaggggaggataatattgtatataaataaaaaaggccctttttagaagggcttttttcttacacaatttgcgcaagaatggctcatcgccaaatgttgtcaaatatgagaaacgggggacattcatattgtgttctaaaagcgtgcattttatacttaacataacaaattatttttggagtgaatacaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0253 Diaminopimelate epimerase ... can be seen here     ..................................................................................................................