Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=75 nt.     Delta G= -6.22 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTAATGGGACGTGTACCGAGGTTATTAAAATCCGGTATCCTCTGGATGTACAAATAT
CATAACGGTTAAtacttaaaaggctgtctactaattagacagtctcttttatgagttaaaatataattatcagacacatttttctcaatat
ggataatgatttatttttcatttttatattaaaaactattgatgaacagtgtatgctatttataagttgttttatttcctttaagaccgaattcattcgg
tcttattttttgtgttgtaaatacttttataggaggcatttcatttcacttATG

    BA_0046


Gene: BA_0046     GI: 21397421     BI number: BA_0046     GOG: -------     Description: hypothetical protein predicted by GeneMar


           tt
          t  a
           ca
           cg
           ta
          t  c
           tc
           ag
           ta
           ta
           tt
          t  t
           gc
           ta
           t
          g
           a
           a
 ta        t
g  t       a
 tg        t
 gc       |
 at       |
c  a      |
 at       t
 at       t
 gt       a
 ta       t         tc
 at       c        t  a
g  a       g        at
 ta        t        at
 tg        a        gc
 at        t        cg
t  t       g        cg
 cg       t         at
 at       g         gc
 at        a        at
 at        c        at
 at        a        ta
                        ttttttgtgttgtaaatacttttataggaggcatttcatttcacttATG


    ..................................................................................................................