                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:209 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCCAGAAATATTAACGTGATCGTCTGCCCAAGAATTCGGCTCTGAAGTAGGATGAGC
ATCAAGGCGAAGTGTTCCTCCATTTTGTTCTTTTAGAAGGTTTATGTACGATTCTGGA
AGCTTTACGTTCAGTACTTCTTCTGCTTTTTTGATTAGTTCGTCGTTAATAGGTGCTA
GTTTTAAATAATCATCTTCTGTCCAAATTGTAGTCTTCATattggatcacctcaaataatagttttaaga
atcttatgtcatatattatagttagtttgaataacgagcaatagagggaggaaataATG

    BA_0051 Gene: BA_0051     GI: 21397426     BI number: BA_0051     GOG: -------     Description: hypothetical protein predicted by GeneMar             C           T  G           T  G           A  C            AT            GC            AT           A  G   G       C  A        G T  G      C  A      G  C A  T       CG       A  G a  G       GT       A  A tA        TA       C  A aT       |  G       TG a  C       CG        AT a  G       TA        CG gT        GT        GT gC        CG        AT aT        TA        GC |  G      A  G      T  C gC        GC        AT gC        TA        GC gC        GT        GC                         ATTTTGTTCTTTTAGAAGGTTTATGTACGATTCTGGAAGCTTTACGTTCAGTACTTCTTCTGCTTTTTTGATTAGTTCGTCGTTAATAGGTGCTAGTTTTAAATAATCATCTTCTGTCCAAATTGTAGTCTTCATattggatcacctcaaataatagttttaagaatcttatgtcatatattatagttagtttgaataacgagcaatagagggaggaaataATG     ..................................................................................................................