Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-17.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagcggctcgttcaaaatgtgagggggatggagcttctgacatagaggcgctttttgcctcggcggaagaagcgaagccaccgaacattttagccgctgg
agctagatattatctagcggctcgttcaaagtcacttgctaaaaggagaccaaatttggtctcctttttttatttaaataacaatcatccgttaacatca
taaaacaaaattggaaatccttctcaaaaaatgcgataattgatactatatagtgaatcgttcacacatatacaatcaaaaaaacatagggggacgacac
ATG

    BA_0059


Gene: BA_0059     GI: 21397434     BI number: BA_0059     GOG: -------     Description: hypothetical protein predicted by GeneMar


  a
g  t
a  a
t  t
c  t
g  a
 at
 gc         c
 gt       a  t
 ta       c  t
 cg        tg
 gc        gc        at
 cg        at       a  t
 cg       a  a       at
 gc       a  a       cg
 at       c  |       cg
t  c       ta        at
t  |       ta        gc
t  |      g  g       at
t  |       cg        gc
a  |       ta        gc
 cg        cg        at
 at       |  a       at
 at        gc        at
 gc        gc        at
                        tttatttaaataacaatcatccgttaacatcataaaacaaaattggaaatccttctcaaaaaatgcgataattgatactatatagtgaatcgttcacacatatacaatcaaaaaaacatagggggacgacacATG


    ..................................................................................................................