Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:63 nt.    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.20 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=29 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-17.87 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tataga. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaatgagtaagtccttgtaaggtatagaaaaaaagacactctttcgagtgtctttcaagatgacaaaatgtgccaattgcttgagtttgataaggcg
ctaatatccgttttaacgccttttctttgatcaagaagtgtagcaacagcgattcaaataaattgtaccatttgttcagtgggcgtgcgtatgcaattgt
gcatatttcaattagagggaaatgaggaacgaaaaatgaatgagtatatatagcatatttgattaggggagagaaggATG

    BA_0062


Gene: BA_0062     GI: 21397437     BI number: BA_0062     GOG: NOG25222     Description: hypothetical protein predicted by GeneMar


 tt
t  c
 cg
 ta
 cg
 at
 cg
 at
 gc
 at
 at
 at
|  c
|  a
|  a
|  g
|  a
|  t
|  g
|  a
a  c
a  a
a  a
a  a
g  a
 at
 tg
 at
 tg
 gc
 gc
a  a       tg
a  a      t  a
t  |       cg        cc
g  |       gt       t  g
t  |      |  t      a  t
t  |      |  t      t  t
c  |      |  g       at
c  |      t  a       at
t  |      t  t       ta
g  |      a  a      c  a
 at       a  a       gc
 at        cg        cg
 tg        cg        gc
 gc        gc        gc
 at        tg        at
 gt        gc        at
                        ttctttgatcaagaagtgtagcaacagcgattcaaataaattgtaccatttgttcagtgggcgtgcgtatgcaattgtgcatatttcaattagagggaaatgaggaacgaaaaatgaatgagtatatatagcatatttgattaggggagagaaggATG


    ..................................................................................................................