                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.10 kcal/mol
Antiterminator:    Distance from promoter:58 nt. Size=43 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:    Distance from promoter:18 nt.    Size=48 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtaa-tagcat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtaatggatcagcaattggatagcattactctcaaaaaagcaccacgctttttcaagggagtagtctgcccattcccattacaaaggaacgtattgca
tctgtagtatgatgtttacggaggttcctctttggggaacctccttttatttttgtctttttctcatgtcttcatactataagacatccaaatagctgta
ttacgttcctttaccactactataagaggtgaaggaaaATG

    BA_0070 Gene: BA_0070     GI: 21397445     BI number: BA_0070     GOG: -------     Description: hypothetical protein predicted by GeneMar   t c  g t  c       ag g  c      t  t a  c      g  a ta       t  t gt        cg at        ta gc        at gc        cg gc        gt |  a      t  t at       t  | at        at         t c  a       ta       t  t t  c       gc       c  g ta       |  g       tg ta       |  g       cg ta       |  a       cg tg       |  g       ta cg        cg        ta |  a       at        gc |  a       at        gc gc        gc        at cg        gc        gc at        at        gc                         ttttatttttgtctttttctcatgtcttcatactataagacatccaaatagctgtattacgttcctttaccactactataagaggtgaaggaaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:91 nt.    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.10 kcal/mol Antiterminator:    Distance from promoter:55 nt. Size=43 nt.     Delta G=-12.10 kcal/mol Anti-antiterminator:    Distance from promoter:18 nt.    Size=48 nt.     Delta G= -7.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtaa-tagcat. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtaatggatcagcaattggatagcattactctcaaaaaagcaccacgctttttcaagggagtagtctgcccattcccattacaaaggaacgtattgca tctgtagtatgatgtttacggaggttcctctttggggaacctccttttatttttgtctttttctcatgtcttcatactataagacatccaaatagctgta ttacgttcctttaccactactataagaggtgaaggaaaATG     BA_0070 Gene: BA_0070     GI: 21397445     BI number: BA_0070     GOG: -------     Description: hypothetical protein predicted by GeneMar   t c  g t  c       tg g  c      c  t a  c      t  a ta       a  g gt        ct at        ga gc        tt gc        tg gc        aa |  a      t  t at       g  | at        cg         t c  a       at       t  t t  c       at       c  g ta       |  t       tg ta       |  a       cg ta       |  c       cg tg       |  g       ta cg        gg        ta |  a       ga        gc |  a       ag        gc gc        ag        at cg        at        gc at        ct        gc                         ttttatttttgtctttttctcatgtcttcatactataagacatccaaatagctgtattacgttcctttaccactactataagaggtgaaggaaaATG     ..................................................................................................................