Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:89 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-15.30 kcal/mol
Antiterminator:    Distance from promoter:36 nt. Size=69 nt.     Delta G= -5.36 kcal/mol
Anti-antiterminator:    Distance from promoter:8 nt.    Size=38 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAC-TAGAAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACAACTTCTTGAAGCGCCGCTAGAATCAGTAACGATTGAAGCCGAAGCTTTAGG
TATTACGGCTGGCACAATCGGAAAAGAAGCATTATTAAAAATGAGATAAgcatatatcgtccct
ccttcttgcatagaaatgatataagaaggaggtttttttATG

    BA_0080


Gene: BA_0080     GI: 21397455     BI number: BA_0080     GOG: NOG07107     Description: hypothetical protein predicted by GeneMar


           AA
          A  T
          A  G
          A  A
           TG
           TA
           AT
           TA
           TA
          A  |
           Cg
           Gc
          |  a
          |  t
          A  a
          A  t
  T       G  a
T  A      A  t
T  G      A  c
 CG       A  g
 GT        At        aa
|  A       Gc       g  a
 AT        Gc        at
 AT       |  c       tg
|  A      |  t      |  a
 GC       |  c      a  t
 CG       C  c      c  a
 CG       T  t       gt
 GC       A  t       ta
 AT       A  c       ta
|  G      C  t       cg
|  G       At        ta
|  C       Cg        ta
A  A       Gc        cg
 GC       |  a       cg
 TA        Gt        ta
 TA        Ta        cg
 AT        Cg        cg
                        tttttttATG


    ..................................................................................................................