                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:197 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -5.86 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGAAATTCAAGATTTTATTAATAAAGAATATAAGGGTGCTGTACTACCAGTAAGTGA
ATAAatatgaaggaaaggactggtaattttccagtccttttttctttatataaataagaagaaaggtgtatcatagaaaggtgaaaaggaaatactt
atatacatttgtgaaaaaattgttacttttttcgtcgtttgcgatatcattttatttgatataaaattagaatgagaataaaatgagaatatgaacgttt
taggaatttttaaaatgtatatataggattaatggaggtattgagATG

    BA_0090 --- BA_0089 --- BA_0088 --- BA_0087 Gene: BA_0090     GI: 21397465     BI number: BA_0090     GOG: COG0396     Description: ABC_tran, ABC transporter Gene: BA_0089     GI: 21397464     BI number: BA_0089     GOG: COG0719     Description: UPF0051, Uncharacterized protein family (UPF0051) Gene: BA_0088     GI: 21397463     BI number: BA_0088     GOG: COG0520     Description: aminotran_5, Aminotransferase class-V Gene: BA_0087     GI: 21397462     BI number: BA_0087     GOG: COG0822     Description: NifU_N, NifU-like N terminal domai            ta           a  t           A  g           A  a           T  a        t           A  g      a  t           A  g      a  t           G  a      t  t           T  a       gc           G  a       gc           A  g       ta ag       A  g       cg g  A       Ta        at t  T       Gc        gc tG        At        gc aT        Cg        at tA        Cg        at gC        At        at gC        Ta        gt                         ttctttatataaataagaagaaaggtgtatcatagaaaggtgaaaaggaaatacttatatacatttgtgaaaaaattgttacttttttcgtcgtttgcgatatcattttatttgatataaaattagaatgagaataaaatgagaatatgaacgttttaggaatttttaaaatgtatatataggattaatggaggtattgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here [C] COG0822 NifU homolog involved in Fe-S cluster formation ... can be seen here     ..................................................................................................................