                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGTTTTAATTAACTCAAACTATGCAATCGATACGAAGTTAAATCCAGAAAAAGATG
CAATTGCAATTGAAAGCAATGATTCACCGTACGCAAACGTAGTAGCTGTTCGTAAAGG
CGATAAAGATAAAAAAGAAATTAAAGAGCTAGTAGAAGTGCTACATTCAAAAGAAATT
GAAGACTTTATTAATAAAGAATATAAAGGGGCAGTTGTTCCTGTAAAAGAATAAttgctg
gggaagggctggtgtatgccggccctttttataactacataattatacgggagaaggggacatcatATG

    BA_0091 Gene: BA_0091     GI: 21397466     BI number: BA_0091     GOG: COG1464     Description: hypothetical protein predicted by GeneMar            AA           G  T           A  A           A  A            At            At            Tg            Gc           |  t           |  g            Tg        ta            Cg       g  t            Cg        tg GT        Ta        gc A  T       Ta        gc CG       G  g       tg GT        Tg        cg GT        Tg        gc GC        Gc        gc GC        At        gc AT        Cg        at                         ttttataactacataattatacgggagaaggggacatcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here     ..................................................................................................................