                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-23.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcgcttcttcctgcaaggcaaaaagcgcctttacgtcagaagctccatccccctcacaatctgaacgagccgcttgcgcttttcattgtctagctccac
ctcctagcccttcatgtctaagaaccttccgcacgagaagacaaaaagcgtcttctgtgcgaaagaaccttagccaacagggctaagcagtcggttccgc
ttttcttttgcaaaaataaacaggaaacaacatgaaaataacgaatatactatatactaagttaaaggttgtatagtatatggtgatcgggtgatgacat
ATG

    BA_0097 --- BA_0096 Gene: BA_0097     GI: 21397472     BI number: BA_0097     GOG: -------     Description: Toprim, The Topoisomerase- primase domain- a nucleotidyl transferase/hydrolase domain Gene: BA_0096     GI: 21397471     BI number: BA_0096     GOG: COG0526     Description: thiored, Thioredoxi   a a  a a  g a  c cg at gc at at gc at g  | cg         c at       a  a cg       a  g gc        cg cg        cg c  a       gc ta        at ta        ta cg        ta c  a      |  g a  a      |  c a  c      |  a gc       |  g at       |  t at       |  c ta        cg cg        cg t  c       at gc        at ta        gc             cgcttttcttttgcaaaaataaacaggaaacaacatgaaaataacgaatatactatatactaagttaaaggttgtatagtatatggtgatcgggtgatgacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here     ..................................................................................................................