Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:173 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.50 kcal/mol
Antiterminator:    Distance from promoter:153 nt. Size=38 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:    Distance from promoter:119 nt.    Size=51 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGATT-TAGAGT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGATTTTTATTACAAAAGGGATAGAGTATAACAGTGCCCGAAAAGATGTAAATGCCA
TGTATACGCAAGGGTTTGCAAATATCGGAAGTGGTGAAGGACAACAATGGGGAATTGG
ATTATCAAATGGTGGAAATGTAGAAGAAAGTATTCATAATATGTATATCGTCGTATTC
CAAACAATTGCAGATTATTTGAATAGAGGATGAgggagcctgtaaacgaggcttcttatttttttatgtagaagct
agtttaagtATG

    BA_0102


Gene: BA_0102     GI: 21397477     BI number: BA_0102     GOG: -------     Description: hypothetical protein predicted by GeneMar


  T
A  T
T  C
G  C
C  A
T  A        T
G  A      A  A
C  C      A  G
T  A      G  A
A  A       TG         a
T  T       TG       a  a
 AT        TA       t  c
 TG        AT       g  g
 GC        TG        ta
 TA        TA        cg
A  G      |  g       cg
 TA       |  g       gc
 AT       |  g       at
 AT       |  a      g  |
 TA       |  g       gt
|  T      A  c       gc
|  T       Gc        At
 AT        At        Gt
 CG        Cg        Ta
 TA        Gt        At
 TA        Ta        Gt
 AT        Ta        Gt
                        ttttatgtagaagctagtttaagtATG


    ..................................................................................................................