                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=56 nt.     Delta G= -3.21 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -5.94 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gatagggggtaggctcagagcctttctggatttttgtaaggaagtcatgtgttttcatgttcattgctcctttaactaataagttttatatgatgcgagg
gttatgatggataggaagtgtttttttgaaatttcatataataattattgcatagcaattctattcctaaaactataaaatataaagttttcataatatg
taaaattgcatattattctttttgaaaaaattgttatattatctttatatttaaattaaatgattttattgagataaatgagaataactggagggatact
GTG

    BA_0109 Gene: BA_0109     GI: 21397484     BI number: BA_0109     GOG: COG1266     Description: Abi, CAAX amino terminal protease famil             a           a  t           a  a   a        at t  t       ta a  a      a  a c  a       ta t  t       cg ta        at ta        at at        at at        at a  a      t  c g  t      c  a t  t      c  t t  g      t  a t  c      t  a t  a      a  | t  t      t  | ta       c  | tg       t  | gc       t  |       aa ta       a  |      a  t g  a      a  |       at a  |      c  |       tg at       g  |       gc gt        at        ta gc        ta        at at        at        ta ta        cg        at at        gt        at gt        ta        ta gc        ta        at                         tctttttgaaaaaattgttatattatctttatatttaaattaaatgattttattgagataaatgagaataactggagggatactGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1266 Predicted metal-dependent membrane protease ... can be seen here     ..................................................................................................................