                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-21.60 kcal/mol
Antiterminator:    Distance from promoter:86 nt. Size=47 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-CATGAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAACGGCGACATGTTACGCATGATGTTATCATCATTACGTAAATTAACTCGCCA
CACACCACTTAACGTAATTCCGAAGAAGCGTGAAATCGCTGCGAAAATTTTAGAAGAT
GAGCGTTATACAGTTTAAtacctttaaagaacagtagtcgtttatacggctactgttcttttttctgaaaaaatgaaatttttagtg
gtataaaactaataccattagtataataaaactaatggtattagttttcgtgaaaagggagatgggaatATG

    BA_0111 --- BA_0110 Gene: BA_0111     GI: 21397486     BI number: BA_0111     GOG: COG0491     Description: lactamase_B, Metallo-beta-lactamase superfamily Gene: BA_0110     GI: 21397485     BI number: BA_0110     GOG: COG1309     Description: hypothetical protein predicted by GeneMar ct c  t a  t t  a A  a A  a Tg Ta        ta Ta       t  t Gc        ta A  a       gc Cg        cg At        tg Ta        gc A  g       at T  t       ta T  |       gc Gc        at Cg        cg Gt        at At        at Gt        gc Ta        at At        at             ttttctgaaaaaatgaaatttttagtggtataaaactaataccattagtataataaaactaatggtattagttttcgtgaaaagggagatgggaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0491 Zn-dependent hydrolases, including glyoxylases ... can be seen here [K] COG1309 Transcriptional regulator ... can be seen here     ..................................................................................................................