Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:139 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-11.50 kcal/mol
Antiterminator:    Distance from promoter:71 nt. Size=78 nt.     Delta G= -9.47 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=52 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TAGAAG. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGGAGATCTTCCTGTCATTCTAGAAGTAATTCAACAAATGCATGAAGTTCCATA
TACGAAAGGTGCACAGCGCGTTGCAACAACAATTCGTATCGATGATCGTCGTGATAAA
GTAAGCACAATGGAGAAAAAATTAAACTCTGTTCGATCAAAATTATAAagaaaagcagcgatct
tcgctgcttttttcatataggaggtagataagATG

    BA_0117


Gene: BA_0117     GI: 21397492     BI number: BA_0117     GOG: NOG13816     Description: hypothetical protein predicted by GeneMar


            A
          A  T
          A  T
          A  A
          A  A
          A  A
           GC
           AT
           GC
           GT
           TG
           AT
           AT
          C  C
          A  G
 AT       C  A
G  C      G  T
 TG       A  C
 AT       A  A
 GC       T  A
 CG       G  A
T  |      A  A
A  |       AT
T  |       AT
 GT        TA
 CG        AT
 TA       |  A
|  T      |  A
T  A      |  a
A  A      |  g
A  A      |  a
 CG       |  a
 AT       |  a
A  A      G  a        c
C  A       Tg       t  t
A  G       Gc       a  t
A  C      C  a       gc
C  A       Tg        cg
 GC        Gc        gc
 TA        Cg        at
 TA        Ta        cg
 GT        At        gc
 CG        Gc        at
                        tttttcatataggaggtagataagATG


    ..................................................................................................................