Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:57 nt.    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.00 kcal/mol
Antiterminator:    Distance from promoter:28 nt. Size=44 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:    Distance from promoter:3 nt.    Size=47 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGGT-TATATT. It has a score value of 71.62 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGGTAGGAGGCGGCTTTATTATATTAGCGCTGCTTTGTGCGATTTTCTCGATTACG
AGAGGACGTTCTACTCAGTTTGCAAAAGAAGAATCTATCGTTTGAtaggttcttttttatttgtaaa
aaatggaagggtttggtgggtagatggagaaaggtgtatatagcgaggtgatggaaaatgATG

    BA_0122


Gene: BA_0122     GI: 21397497     BI number: BA_0122     GOG: -------     Description: hypothetical protein predicted by GeneMar


 TT         T
A  A      T  G
 GC       T  C
 CG       G  A
 TA       A  A
 CG       C  A
 TA        TA
 TG        CG
 TG       A  A
 TA        TA        TT
A  |       CG       G  T
 GC        TA        CG
 CG        TA        TA
 GT       G  |       At
T  T      C  |       Ta
G  C       AT        Cg
T  T       GC        Tg
T  A       GT        At
T  C      A  A       At
C  T      G  |       Gc
 GC        AT        At
 TA        GC        At
 CG        CG        Gt
 GT        AT        At
                        ttatttgtaaaaaatggaagggtttggtgggtagatggagaaaggtgtatatagcgaggtgatggaaaatgATG


    ..................................................................................................................