                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:43 nt.    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.90 kcal/mol
Antiterminator:    Distance from promoter:25 nt. Size=32 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-TATATT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTTTACGGGACTTCCGGTATATTGGTATTTAAATAAGAAGAACAAAACTGAAGT
GTCATAAttgaaaggtaggcgtatcatacgcctaccttttttgctgtaaaaaaattgtacttgtgttcaacttctattttggttactatagtcgt
agtaaccaaaatagaaagcgtggggaaagacTTG

    BA_0123 Gene: BA_0123     GI: 21397498     BI number: BA_0123     GOG: COG2814     Description: sugar_tr, Sugar (and other) transporte AT A  A A  A TG TA TA A  G T  A       aa G  A      g  a GC        tg TA        tg TA        At         c A  A      A  a      t  a T  |      T  |       at A  |      A  |       ta TA        Cg        gc GC        Tg        cg GT        Gc        gc C  |       Tg        gc CG       G  t       at TA       A  a       ta TA        At        gc CG        Gc        gc AT        Ta        at                         tttttgctgtaaaaaaattgtacttgtgttcaacttctattttggttactatagtcgtagtaaccaaaatagaaagcgtggggaaagacTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2814 Arabinose efflux permease ... can be seen here     ..................................................................................................................