                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-22.60 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-13.40 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATTCTATCGCGCAAACCCTGACAAACACGGCTTAGTACAAGGCAGTGGTCTTGGGTT
ATACATTGTAAAACAAATACTAGATAAACATCAATTTCCTTATGGGATACAAAACACG
CCTCAAGGTGTAAAATGTTCTATCGTATTCCCAAAAGCAATGTAAaaacctactacaatctcatacc
ccaaattcatacttcgtatgagtggcggaattttgtagagtatattactctgtttcgttcgcccgttatccttatttggatagcgggcgttttttattat
ttaaaaggaggatttccATG

    BA_0139 Gene: BA_0139     GI: 21397514     BI number: BA_0139     GOG: COG0697     Description: hypothetical protein predicted by GeneMar   t t  c cg at ta at cg ta t  g        a a  |      t  t a  |       at at        ta cg        gc cg        at |  c       gc        at cg        at       t  t cg        tg       t  t a  a      g  t       cg ta       t  t       cg at       t  t       ta c  t      t  c       at t  |      t  g       ta c  |      a  |       tg t  |       at        gc at        gt        cg at        gc        cg cg        cg        cg at        gc        gc ta        gc        cg                         ttttttattatttaaaaggaggatttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-22.60 kcal/mol Antiterminator: Size=40 nt.     Delta G=-13.40 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G= -9.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATTCTATCGCGCAAACCCTGACAAACACGGCTTAGTACAAGGCAGTGGTCTTGGGTT ATACATTGTAAAACAAATACTAGATAAACATCAATTTCCTTATGGGATACAAAACACG CCTCAAGGTGTAAAATGTTCTATCGTATTCCCAAAAGCAATGTAAaaacctactacaatctcatacc ccaaattcatacttcgtatgagtggcggaattttgtagagtatattactctgtttcgttcgcccgttatccttatttggatagcgggcgttttttattat ttaaaaggaggatttccATG     BA_0139 Gene: BA_0139     GI: 21397514     BI number: BA_0139     GOG: COG0697     Description: hypothetical protein predicted by GeneMar   t t  c cg at ta at cg ta         t t  g      t  a a  |       ac a  |       tt at        ac cg        tt cg        gg        at |  c       at       t  t cg        gt       t  t cg       a  t       cg |  a      t  c       cg |  a      g  g       ta |  t      t  t       at a  t      t  t       ta t  t      t  |       tg at        tc        gc cg        ag        cg |  t       ac        cg ta        gc        cg cg        gc        gc ta        cg        cg                         ttttttattatttaaaaggaggatttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................