                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-32.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.31 kcal/mol
Anti-antiterminator:   Size=10 nt.     Delta G= -1.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: aaggtggtaccgcg is shown in italic-bold style

aagtaggatgaacacattctttccagagagcttcggtagctgagaagaagcaagaatattcatttgaacaatggcctttgagcttcgtcctgaacttatc
aaatgataatagtaggcggcgacgagagttggtactcgttatcaaaaccacagtataagagcatatagctccgtacttgttaaggctaattatgtgagta
attggcgaaataaggtggtaccgcgactgtttatacagccccgcccttatcttttttagataagggcggggctttttatatttaaaaggaggaatgtaag
ATG

    BA_0140 Gene: BA_0140     GI: 21397515     BI number: BA_0140     GOG: COG0143     Description: tRNA-synt_1, tRNA synthetases class I (I, L, M and V            ta           t  t            ta            gc            ta            cg           |  c        t           |  c      t  t           a  c      t  t            gc        ta            cg        cg            gc        ta           c  |       at           c  |       ta           a  |       ta           t  |       cg           g  |       cg           g  |       cg           t  |       gc            gc        cg ta        gc        cg g  c       at        cg gc        at        cg tg        ta        gc gc        at        at                         ttttatatttaaaaggaggaatgtaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0143 Methionyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................