                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.40 kcal/mol

                                                                        Nomenclature/Definitions

TAATGTCAGTACTAAAACCATTCTCAGCACTATACGTGCTTATACTATCAATCTTAGG
TCCACTTCTGACGAAAGAGTCAAAGAATGTATATAAATTGTTAAATAAAATCTTTAAG
TGGGATATGAAGAAGAGCTAAatttttaaaaatcaaagtacaaaatatgtatgaaaaagggatctatgtcgacatagatcccttt
ttttattggcatttttttaggatgaaagaatacgtttaatatttaccatattgtggcatacatatagaaaaaggtgcttggaaaggggaataaagagaaA
TG

    BA_0147 Gene: BA_0147     GI: 21397522     BI number: BA_0147     GOG: -------     Description: hypothetical protein predicted by GeneMar           cg          t  a           gc           ta           at           ta           cg           ta           at           gc           gc           gc             tttttttattggcatttttttaggatgaaagaatacgtttaatatttaccatattgtggcatacatatagaaaaaggtgcttggaaaggggaataaagagaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:43 nt.    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-19.70 kcal/mol Antiterminator:    Distance from promoter:11 nt. Size=64 nt.     Delta G= -5.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTAAAT-TATGAA. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTAAATAAAATCTTTAAGTGGGATATGAAGAAGAGCTAAatttttaaaaatcaaagtacaaaatatgtatg aaaaagggatctatgtcgacatagatccctttttttattggcatttttttaggatgaaagaatacgtttaatatttaccatattgtggcatacatataga aaaaggtgcttggaaaggggaataaagagaaATG     BA_0147 Gene: BA_0147     GI: 21397522     BI number: BA_0147     GOG: -------     Description: hypothetical protein predicted by GeneMar   g g  g a  a at ac at aa gt t  g a  | t  | g  | t  | a  | t  | a  | a  | a  | at cc ag ta g        cg a        t  a a  |       gc a  |       ta c        at t        ta a         cg a        ta a        at a        gc a         gc t         gc t         at t        at t        at t        at             tttattggcatttttttaggatgaaagaatacgtttaatatttaccatattgtggcatacatatagaaaaaggtgcttggaaaggggaataaagagaaATG     ..................................................................................................................