                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -6.11 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: tgggtggtaacacg is shown in italic-bold style

caattcaatataatggctaataatttaacaaataacatacgttgaaagagcccagtagcagtttgtcactgttaacgagagagctaggggatgctggaac
ctagcacaaacaaacttgcgaattacactctggagtatcttaggtaatgctaagcggattggcaatcgatattattgctaagagtggtatgagtagctat
gctatttatacaaactgggtggtaacacggtgaataatcgtccctatgtcatagacatagggattttttgtttttaaaaaaataaaggggatgacaaaag
ATG

    BA_0173 Gene: BA_0173     GI: 21397548     BI number: BA_0173     GOG: COG0162     Description: tRNA-synt_1b, tRNA synthetases class I (W and Y             a           a  t           g  a            ta   a        gt t  t       gc cg        cg gc        at at       c  | ta       a  | gt       a  | at       t  | gt       g  | ta       g  | at       t  | ta        gc gc        gc |  a       gc         t g  a      t  t      a  a ta       c  a       cg gc       a  |       ta at       a  |       gc |  g       at        ta g  g       cg        at a  g       at        ta at       |  c       cg tg        ta        cg cg        at        cg gt        ta        ta ta        tg        gt                         tttttgtttttaaaaaaataaaggggatgacaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0162 Tyrosyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-14.00 kcal/mol Antiterminator: Size=49 nt.     Delta G= -6.11 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G=-16.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: tgggtggtaacacg is shown in italic-bold style caattcaatataatggctaataatttaacaaataacatacgttgaaagagcccagtagcagtttgtcactgttaacgagagagctaggggatgctggaac ctagcacaaacaaacttgcgaattacactctggagtatcttaggtaatgctaagcggattggcaatcgatattattgctaagagtggtatgagtagctat gctatttatacaaactgggtggtaacacggtgaataatcgtccctatgtcatagacatagggattttttgtttttaaaaaaataaaggggatgacaaaag ATG     BA_0173 Gene: BA_0173     GI: 21397548     BI number: BA_0173     GOG: COG0162     Description: tRNA-synt_1b, tRNA synthetases class I (W and Y             a           g  a           t  t   a        ga t  t       ga cg        ct gc        ac at        cg ta       a  | gt       a  | at       t  | gt       g  | ta       g  | at       t  | ta       g  | gc        gt |  a       gc g  a       tc ta       c  c        t gc       a  t      a  a at       a  |       cg |  g      a  |       ta g  g       ca        gc a  g       at        ta at        tg        at tg       |  t       ta cg        ac        cg gt        ta        cg ta        tt        cg ta        ta        ta                         ttttttgtttttaaaaaaataaaggggatgacaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0162 Tyrosyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................