                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=76 nt.     Delta G= -9.02 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAAACTTCTGCGGCTACAGAAGAAGTGTTAGCAAGTGTGGAAGAAGAAAAACATCG
AAACGATACATCTGTGAAGACATTACATACGGTTAGCGAGCAAGTGAAATTGTTAGAA
GATATTTTAGAAAAGTAAtatcacttaaaaagagcacaatgtttgtgctcttttttcatttaaatgaagacttgctcggaatttaat
tgcttttctgcgcgttttctgccaagcttaaggagataaaattcagctaatagcggaattaaaatacttcaaagaaagaattatataggtgacgcatAT
G

    BA_0175 Gene: BA_0175     GI: 21397550     BI number: BA_0175     GOG: COG2940     Description: SET, SET (Su(var)3-9, Enhancer-of-zeste, Trithorax) domai            AT           G  A            AT            AT            GT            AT            TA            TG           |  A           |  A           |  A           |  A           |  G GC        GT A  G       TA TA        TA TG        At GC       A  a G  A       At C  A       Gc A  |       Ta TG        Gc AT        At CG        At |  A      C  a A  A      G  a T  A      A  a T  T      G  a AT       C  a CG       G  g AT       A  |        g GT        Ta       t  t A  A       Tg        at A  G       Gc        at G  A      G  a       cg T  |      C  c       at G  |      A  a       cg TA        Ta        gc CG        At        at TA        Cg        gc AT        At        at                         tttttcatttaaatgaagacttgctcggaatttaattgcttttctgcgcgttttctgccaagcttaaggagataaaattcagctaatagcggaattaaaatacttcaaagaaagaattatataggtgacgcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2940 Proteins containing SET domain ... can be seen here     ..................................................................................................................