                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:136 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.70 kcal/mol
Antiterminator:    Distance from promoter:106 nt. Size=36 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=16 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atcaca-tatatt. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atcacaacaaaaatcttatatcattatatttagtttataaataattgttcttacctttaaatgatcaaaactccgactccttcactggaaatcaagcgaa
atgtttagtacactatatgtaataatcataggcgatggagttcgccataaacgctgcttagctaatgactcctaccagtataactactggtaggagtcta
tttttttgagcaagctatttaaagaggtgagaaaaTTG

    BA_0179 --- BA_0180 Gene: BA_0179     GI: 21397554     BI number: BA_0179     GOG: COG0239     Description: CRCB, CrcB-like protein Gene: BA_0180     GI: 21397555     BI number: BA_0180     GOG: COG0239     Description: CRCB, CrcB-like protei            ct           g  t            ta            cg            gc           c  t       aa           a  a      t  c           a  |       at           a  |       ta            ta        gc            at        at            cg        cg           c  |       cg ga       g  |       at g  g      c  |       ta t  t      t  |       cg at        ta        cg gc        gc        ta cg        at        cg gc        gc        at gc        gc        gc                         tatttttttgagcaagctatttaaagaggtgagaaaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG0239 Integral membrane protein possibly involved in chromosome condensation ... can be seen here [D] COG0239 Integral membrane protein possibly involved in chromosome condensation ... can be seen here     ..................................................................................................................