Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:82 nt.    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -9.30 kcal/mol
Antiterminator:    Distance from promoter:58 nt. Size=41 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:    Distance from promoter:20 nt.    Size=41 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGATT-AACGAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGATTTTAGCAATTATTTCTTTAACGATACATGCTTCAAACAGTAAAGTAGGAGCGA
ATGGATTTCTTGAAGAACCTTTCTTTTTCTTAGTACCGATAAGTTATGTATTGTCCCT
TAGTGGTATTGGTGTATTACTATTTGGATTTATTACTTCAAAGCTGAAAAAGAGCAAT
AGATAGggctgttaatcgggacaaaacactcctcatgaaatagaaacatacgatatggaagaaaaatcataagtgagttgaataATG

    BA_0181


Gene: BA_0181     GI: 21397556     BI number: BA_0181     GOG: -------     Description: hypothetical protein predicted by GeneMar


  G
T  A
T  A        A
 CG       T  T
 TA       G  T
 TA        TG
T  |       AT        GG
A  |      T  C      T  T
 GC       T  C       TG
 GC        GC        AT
T  T       AT        TA
 AT        AT        GT
 AT        TA        GT
 GC       A  G       TA
|  T       GT        GC
|  T       CG        AT
C  T       CG        TA
 GT        AT       |  T
 AT        TA       T  T
 GC        GT       C  T
 GT        AT        CG
 AT        TG        CG
 TA        TG        TA
                        TTTATTACTTCAAAGCTGAAAAAGAGCAATAGATAGggctgttaatcgggacaaaacactcctcatgaaatagaaacatacgatatggaagaaaaatcataagtgagttgaataATG


    ..................................................................................................................