                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTCTTTTGGGACTGCTCTTATCTCTGTTGCAGTTGGAATTGTTGCAGCTGTTATT
GGAAACTTACCTTTCTTAGGGTTAATTGTTCCAAATATTGTTTCCATGTTTAGAGGTG
ATGATCTTAGAAGTAATTTACCTTGGGTGTGTGTCATCGGAATGGGGACAATAACTGC
CTGTGACATCATttctcgaacaattataaagccttttgaattacctgtttctttaatacttgcatcagtgggagcagttgtgtttattact
attttattgagaaaaagaaaaccaaggaggctacgATG

    BA_0188 --- BA_0187 Gene: BA_0188     GI: 21397563     BI number: BA_0188     GOG: COG4605     Description: FecCD_family, FecCD transport family Gene: BA_0187     GI: 21397562     BI number: BA_0187     GOG: COG4604     Description: ABC_tran, ABC transporte             T        CT           T  G      T  T   G        AT        TA T  T       AT        TG A  C      G  G       CG gT        GC        CG cG        TA        AT aT        TG       |  T t  T       GC       |  A cG        AT       T  A gC        CG       T  T g  A       GT       C  T a  G      |  T      A  G g  |      T  A       AT g  |      T  T       AT aT        GT        GC aT        TG        GC cG        CG        TA cG        TA        TA                         ATATTGTTTCCATGTTTAGAGGTGATGATCTTAGAAGTAATTTACCTTGGGTGTGTGTCATCGGAATGGGGACAATAACTGCCTGTGACATCATttctcgaacaattataaagccttttgaattacctgtttctttaatacttgcatcagtgggagcagttgtgtttattactattttattgagaaaaagaaaaccaaggaggctacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG4605 ABC-type enterochelin transport system, permease component ... can be seen here [P] COG4604 ABC-type enterochelin transport system, ATPase component ... can be seen here     ..................................................................................................................