                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTCTTCGAAAACGTACCAGGATTCAAGAAGAAAAAGAAAAAGCGTAAGTAAgaaaaggat
ggcttcgctttgatgaaaagcgaggctttttcttttttattggtggcttgagagcgagttactttcctcttttattggaatccagctacagtggctagaa
tgttcggcggcttcgcttcttcccgagaggcaaagagcgcctcaaggtcagaagctccatccacctcacattctgaacgagccactttcgctttttagta
acatttgttacaatagtaaaaatagaggagggacgttatATG

    BA_0193 Gene: BA_0193     GI: 21397568     BI number: BA_0193     GOG: COG0691     Description: SmpB, SmpB protei             t           a  g           g  a            ta aa        ta a  g       ta a  g       cg g  a       gc A  t       cg A  g       ta Tg        tg Gc        cg At        gc At        gt T  |      |  t Gc       |  t Cg       t  t Gc        at At        gc At        gt At        at             ttttattggtggcttgagagcgagttactttcctcttttattggaatccagctacagtggctagaatgttcggcggcttcgcttcttcccgagaggcaaagagcgcctcaaggtcagaagctccatccacctcacattctgaacgagccactttcgctttttagtaacatttgttacaatagtaaaaatagaggagggacgttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0691 tmRNA-binding protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:207 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.60 kcal/mol Antiterminator: Size=33 nt.     Delta G= -7.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATTCTTCGAAAACGTACCAGGATTCAAGAAGAAAAAGAAAAAGCGTAAGTAAgaaaaggat ggcttcgctttgatgaaaagcgaggctttttcttttttattggtggcttgagagcgagttactttcctcttttattggaatccagctacagtggctagaa tgttcggcggcttcgcttcttcccgagaggcaaagagcgcctcaaggtcagaagctccatccacctcacattctgaacgagccactttcgctttttagta acatttgttacaatagtaaaaatagaggagggacgttatATG     BA_0193 Gene: BA_0193     GI: 21397568     BI number: BA_0193     GOG: COG0691     Description: SmpB, SmpB protei GC A  G A  T A  A        t A  A      a  g A  G      g  a GT        ta AA        ta AA        ta Ag        cg A  |       gc Aa        cg Ga        ta Aa        tg Aa        cg Gg        gc Ag        gt             ttttcttttttattggtggcttgagagcgagttactttcctcttttattggaatccagctacagtggctagaatgttcggcggcttcgcttcttcccgagaggcaaagagcgcctcaaggtcagaagctccatccacctcacattctgaacgagccactttcgctttttagtaacatttgttacaatagtaaaaatagaggagggacgttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0691 tmRNA-binding protein ... can be seen here     ..................................................................................................................