                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTAATACAGATAGTGCGAACATTATTTATAACGGTGTAGAATCAACGTTAAAAGACA
TTAAATGGTATGAAGACTCTACGCATGTCATTACACTTGATAAGCAGCGTGACGAGCT
ACATGAGGATGTATATAACTTCTTGGAGCAACTAGATTGGTAAgatctagttgcctcttttttcataa
ggaattttttgtgaaaactgtaaaaatcataaggggagtattgaagtttcgctttatacatcccctatctttcggatacactaaataatataaggmttta
aaggaggtatttttgcTTG

    BA_0194 Gene: BA_0194     GI: 21397569     BI number: BA_0194     GOG: COG0557     Description: RNB, RNB-like protei   C A  A T  C T  T AT CG TA GT TA |  A |  G |  C                  T A  A                G  A CG        AT       G  A GC       T  A       Tg CG       G  T       Ta AT       T  A       At TG       A  A       Gc |  A       GC        At |  C       GT        Ta CG        AT        Cg TA        GC        At CG       T  T       At A  |       AT        Cg GC        CG       |  c AT       A  G       Gc A  A       TA        At GC        CG        Gc TA        GC        Gt                         tttttcataaggaattttttgtgaaaactgtaaaaatcataaggggagtattgaagtttcgctttatacatcccctatctttcggatacactaaataatataaggmtttaaaggaggtatttttgcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0557 Exoribonuclease R ... can be seen here     ..................................................................................................................