                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.34 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTACAGGCCCGCTTTTATTAAAATGGAGCCGCGTTACAAACTCAGTTGGTAAAGGGAT
CGGATTTGGATGTGCTTCTCATATTATGGGTGTGATGAGAGCGATGAAAAATAATGAA
CATGAAGGTGTTATTGGATCGGTAACAATGACATTAACAGCCATTTTGACATGTTTGC
TCGGGCCGTTATTTGCAATGATGTTCATGTAAgagaagaaaagcgagagcgactgtatagctctcgcttttctata
gaatttatgctacagttacaataactgaatttttgtaggaggtacgccaaGTG

    BA_0196 Gene: BA_0196     GI: 21397571     BI number: BA_0196     GOG: -------     Description: hypothetical protein predicted by GeneMar            GT           T  A           A  A GT        Cg T  T       Ta AT        Tg CG       G  a |  C      T  a AT       A  g GC       G  a TG       T  a        g T  |      A  a      t  t T  |      A  a      c  a T  |       Cg       a  t A  |       Gc       g  a CG        Tg        cg CG        Ta        gc GC        Tg        at A  C      A  |       gc CG        Ta        at AT        Tg        gc AT        Gc        cg TA        Cg        gc                         ttttctatagaatttatgctacagttacaataactgaatttttgtaggaggtacgccaaGTG     ..................................................................................................................