                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.60 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-14.02 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagtaacttaaaccttccatttttgttacgctcttttcggttatagcgagtcttgtcaatgttcagggagtatgagttttgaatattaatattcaatttt
ccgtacttcttccaatgttgataacacaacattaaatacaatcaaaggaggatagaacgttcgtgttctatctttcgattaaagctagacatcagcaatt
tattagctctttattgttggtgtcgatgatttaattgaacccctaaagctcgtaacttcggttacgggctttttattttgatttagaaaggaaagattgc
ATG

    BA_0217 --- BA_0218 Gene: BA_0217     GI: 21397592     BI number: BA_0217     GOG: COG4695     Description: DAGKa, Diacylglycerol kinase accessory domain (presumed) Gene: BA_0218     GI: 21397593     BI number: BA_0218     GOG: COG3740     Description: hypothetical protein predicted by GeneMar   g a  c t  t t  c a  t t  t t  t ta at at cg gt at cg tg at cg at gc |  g |  a |  t |  g |  a |  t |  t |  t |  a |  a |  t |  t |  g       tc |  a      t  g |  a       cg |  c       at |  c       at |  c       ta |  c       gc |  t       cg |  a       tg a  a       cg ta        gc cg        at gc        at at        at             ttattttgatttagaaaggaaagattgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4695 Phage-related protein ... can be seen here [R] COG3740 Phage head maturation protease ... can be seen here     ..................................................................................................................