                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:167 nt.    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-15.60 kcal/mol
Antiterminator:    Distance from promoter:138 nt. Size=38 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:    Distance from promoter:111 nt.    Size=46 nt.     Delta G=-10.52 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTACA-TACATC. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTACATGGAAGCTCGTATTTCCCCTACATCTTACGGGAAAGATTACCACCAATTAAT
TCAAGACGGTTTGCTTACCAATATGTCCTTTGGTATGCAAGTTACAGAACAAAGATGG
GATAAACGAGATGACGGAACATACAAGCGTACAATTTCTGATTTACATTTAGCTGAGG
TCTCCGTGGTACGCAATCAAGCATACAGGCTCGTTCGATTGAAGTAAtcgaaacgcctgtttttt
ttatggaaaaaaacgataaaaactcaacggaggaacctattATG

    BA_0219 Gene: BA_0219     GI: 21397594     BI number: BA_0219     GOG: -------     Description: hypothetical protein predicted by GeneMar TA T  G T  C       TC AT       A  A CG       A  A A  |       CG         A TA        GC       A  G TG       C  A       GT TG        AT        TA AT        TA        TA GC        GC        At T  T      G  A       Gc C  C      T  |       Cg T  C      G  |       Ta T  G       CG        Ta T  T       CG       G  a A  G      T  |      C  c A  |      C  |      T  | CG       T  |       Cg AT       G  |       Gc TA        GC        Gc GC        AT        At CG        GC        Cg GC        TG        At                         tttttttatggaaaaaaacgataaaaactcaacggaggaacctattATG     ..................................................................................................................