Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:80 nt.    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.80 kcal/mol
Antiterminator:    Distance from promoter:20 nt. Size=73 nt.     Delta G= -7.56 kcal/mol
Anti-antiterminator:    Distance from promoter:11 nt.    Size=41 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGTA-TACTCT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTACGATAACGAAACAGGTTACTCTAACCGCGTAGTAGACTTAGCAGCTTACATG
ACTTCAAAAGGTCTTTAAttcttaattatataagttatcaatgacaaaacgagggagagggtttgttccctctctctcttctttcgt
tttaaaagcaaatgtgttaagcttttgagtgggttttgtcaatcctaactagtagtcggagggaaatccaATG

    BA_0226 --- BA_0225 --- BA_0224 --- BA_0223


Gene: BA_0226     GI: 21397601     BI number: BA_0226     GOG: COG0126     Description: PGK, Phosphoglycerate kinase
Gene: BA_0225     GI: 21397600     BI number: BA_0225     GOG: COG0149     Description: TIM, Triosephosphate isomerase
Gene: BA_0224     GI: 21397599     BI number: BA_0224     GOG: COG0696     Description: Metalloenzyme, Metalloenzyme superfamily
Gene: BA_0223     GI: 21397598     BI number: BA_0223     GOG: COG0148     Description: enolase, Enol-as


           ta
          t  t
          a  a
           at
           ta
           ta
           cg
          |  t
          t  t
          t  a
          A  t
          A  c
          T  a
          T  a
          T  t
           Cg
           Ta
 CT        Gc
A  T      G  a
 GC       A  a
 TA       A  a
A  A      A  a
C  A      A  c
A  |       Cg
 TA        Ta        tg
 TG        Tg       t  t
 CG        Cg       t  t
 GT       A  g       gc
A  C      G  a       gc
C  T      T  g       gc
 GT       A  a       at
 AT       C  |       gc
 TA       A  |       at
 TA        Tg        gc
C  t       Tg        gt
 At        Cg        gc
 Gc        Gt        at
 At        At        gc
                        ttctttcgttttaaaagcaaatgtgttaagcttttgagtgggttttgtcaatcctaactagtagtcggagggaaatccaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG0126 3-phosphoglycerate kinase ... can be seen here
[G] COG0149 Triosephosphate isomerase ... can be seen here
[G] COG0696 Phosphoglyceromutase ... can be seen here
[G] COG0148 Enolase ... can be seen here

    ..................................................................................................................